Ronin Genetics 
 





or tarandall@roningenetics.org


“night science”: a stumbling, wandering exploration
of the natural world that relies on intuition as much as it does on the cold, orderly logic of

“day science.” In today’s vastly expanded scientific enterprise, obsessed with impact factors

and competition, we will need much more night science to unveil the many mysteries

that remain about the workings of organisms.


Francois Jacob, Science 332: 767

Genotyping




apoE genotyping from human DNA


This PCR procedure is modified from the paper "Simple Sequence-specific-Primer-PCR Method To Identify
the Three Main Apolipoprotein E Haplotypes"; Clinical Chemistry 49: 1945. Reading the paper would be useful for interpreting the results.

Primers: these are primers from the paper, purchased from Operon (www.operon.com).
All primers are stored at a 1 mg/ml concentration in ddH2O at -20C and used at 1 ul / 50 ul PCR reaction mix.
PRIMER-1         CGGACATGGAGGACGTGT
PRIMER-2         CTGGTACACTGCCAGGCG
PRIMER-3         CTGGTACACTGCCAGGCA
PRIMER-4         CGGACATGGAGGACGTGC
HLA_control-F   TGCCAAGTGGAGCACCCAA
HLA_control-R   GCATCTTGCTCTGTGCAGAT

The PCR protocol is not what is used in the paper, but  a much simpler one step PCR protocol I tried which was successful. It is being done on an old PE 480 Thermocycler, for a more modern machine one might want to cut the various cycle times. If I wanted to do this again, I would run 35-40 cycles.
5 min 94C; 1 cycle
1 min 94C, 1 min 60C, 2 min 72C; 30 cycles
5 min 72C; 1 cycle
12C storage step until removal to 4C refrigerator.

3 PCR samples per genomic template, each primer mix should also include both control HLA primers
E2 primer mix (primers 1&3)
E3 primer mix (primers 1&2)
E4 primer mix (primers 2&4)

Each PCR reaction is in a vol of 50 ul:
10 X PCR buffer (NEB)    5 ul
10 mM dNTP stock          1 ul
each primer                       1 ul
DNA                                1 ul
Taq (Sibgene)              0.25 ul
ddH2O                       to 50 ul

Run aliquot of each (10-15 ul of a 50 ul PCR reaction) on a 1% agarose gel (1.5% would be good also since the allele specific bands are small, <300 bp) alongside 100 bp ladder (NEB) or other available small fragment marker.


Remember to do the control primers as the presence/absence of an allele specific band in the three PCR reactions defines the genotype and this is meaningless unless the control band is in all three lanes.
A good confirmatory experiment would be the Hha I digest discussed in the paper as only the E4 allele (linked to the disease state) will have the Hha I site and produce two bands. I have done this by amplifying DNA with two primers (apoEF; CTCTCCCTCTTGGGTCTCTCTGGCT and  apoER; CAGGCTTCGGCGTTCAGTGATTGTC) that I designed that produce an ~800 bp fragment around the polymorphism in question and doing a restriction digest on this fragment.



DNA preparation from blood sample.
This is adapted from the following link http://www.genome.ou.edu/protocol_book/protocol_partIII.html#III.H

1. Blood sample is obtained as 0.5 ml of whole blood. Sterilize single edge razor and little finger with 70% EtOH. Have 1.5 ml eppendorf tube containing 0.4 ml of 1X SSC buffer ready, mark tube with Sharpie at the 0.9 ml level. Have bandaid ready.

2. Make small cut in finger and squeeze into tube containing buffer, mix when mark is reached. Centrifuge for 1 minute at 12,000 rpm in a microcentrifuge. (Use bandaid on finger!)

3. Remove the supernatant and discard into 10% bleach

4. Add 0.5 ml of 1X SSC buffer, vortex, centrifuge as above for 1 minute, and remove all of the supernatant.

5. Add 187 ul of 0.2M NaOAc to each pellet and vortex briefly. Then add 12.5 ul of 10% SDS and 5 ul of proteinase K (20 mg/ml H2O), vortex briefly and incubate for 1 hour at 55C.

6. Add equal vol of phenol/chloroform/isoamyl alcohol and vortex for 30 seconds. Centrifuge the sample for 2 minutes at 12,000 rpm in a microcentrifuge tube.

7. Carefully remove the aqueous layer to a new 1.5 ml microcentrifuge tube, add 2 vol of cold 95% ethanol, mix, and incubate for 15 min at -20C. Good stop point in protocol as one can leave this overnight.

8. Centrifuge for 2 minutes at 12,000 rpm in a microcentrifuge. Decant the supernatant and drain.

9. Add 180 ul TE, pH 8, vortex, and incubate at 55C for 10 minutes.

10. Add 20 ul 3M sodium acetate and mix. Add 500 ul of cold 100% ethanol, mix, and centrifuge for 1 minute at 12,000 rpm in a microcentrifuge.

11. Decant the supernatant and rinse the pellet with 1 ml of 70% ethanol. Centrifuge for 1 minute at 12,000 rpm in a microcentrifuge.

12. Decant the supernatant, and either air dry the pellet ior dry in dessicator.

13. Resuspend the pellet in TE buffer, amount depends on size of pellet, usually 20-50 ul TE.

14. Quantitate an aliquot on an agarose gel and store at -20C.